SubtiBank SubtiBank
Version comparison:

2017-8-11 16:0:32025-05-25 21:47:48

_ec

description

DNA translocase

DNA translocase, translocation of non-segregated chromosomes prior to septum closure

locus

BSU29805

BSU_29805

geneLength

2856

2859

outlinks

bsu

BSU29805

BSU_29805

The protein

Catalyzed reaction/ biological activity

aids in moving DNA away from the closing septum, binds DNA, DNA-dependent ATPase activity [Pubmed|19818024]

the two DNA translocases [[protein|SftA]] and [[protein|SpoIIIE]] synergistically affect chromosome dimer resolution presumably by positioning the dif sites in close proximity, before or after completion of cell division, respectively [Pubmed|21239579]

aids in moving DNA away from the closing septum, binds DNA, DNA-dependent ATPase activity [Pubmed|19818024]

translocation of non-segregated chromosomes prior to septum closure

the two DNA translocases [[protein|SftA]] and [[protein|SpoIIIE]] synergistically affect chromosome dimer resolution presumably by positioning the dif sites in close proximity, before or after completion of cell division, respectively [Pubmed|21239579]

The protein

Paralogous protein(s)

[[protein|SpoIIIE]]

[[this]]

The protein

[SW|Localization]

cytoplasm (Homogeneous) [Pubmed|28110333,16479537]

small fraction at the membrane [Pubmed|28110333]

co-localizes with [[protein|FtsZ]] at nascent division sites [Pubmed|19788545]

30% of the molecules in the cytoplasm (Homogeneous) [Pubmed|29439991,28110333,16479537]

small fraction at the membrane [Pubmed|28110333]

70% of the molecules are septum-bound, co-localizes with [[protein|FtsZ]] at nascent division sites, recruitment to the septum depends on [[protein|FtsA ]][Pubmed|29439991,19788545]

Biological materials

Mutant

MGNA-A438 (ytpS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/438 NBRP B. subtilis, Japan]

1A984 ( ''sftA''::''spec''), [Pubmed|19788545], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A984&Search=1A984 BGSC]

BKE29805 (''[[gene|sftA]]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]

MGNA-A438 (ytpS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/438 NBRP B. subtilis, Japan]

1A984 ( ''sftA''::''spec''), [Pubmed|19788545], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A984&Search=1A984 BGSC]

BKE29805 (''[[gene|sftA]]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]

BKE29805 (Δ[[gene|sftA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29805 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTATCTCTAACTCC, downstream forward: _UP4_TAATATGGGTTCATTTTCAC

BKK29805 (Δ[[gene|sftA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29805 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTATCTCTAACTCC, downstream forward: _UP4_TAATATGGGTTCATTTTCAC

References

Original publications

16479537, 19788545, 19818024, 21239579, 16916635, 27891124, 28110333

29439991, 16479537, 19788545, 19818024, 21239579, 16916635, 27891124, 28110333

The protein

Protein family

FtsK/SpoIIIE/SftA family (with [[protein|SpoIIIE]], according to UniProt)

The protein

[SW|Domains]

[SW|FtsK domain] (aa 622-813) (according to UniProt)